SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DEAD-box RNA helicase, important for adaptation to low temperatures
49.86 kDa
protein length
438 aa Sequence Blast
gene length
1317 bp Sequence Blast
RNA helicase
DEAD-box RNA helicase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.3|DEAD-box RNA helicases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosome assembly]
  • Gene

    2,594,184 → 2,595,500

    Phenotypes of a mutant

  • poor growth at low temperatures (16 to 20°C) [Pubmed|23175651]
  • The protein

    Catalyzed reaction/ biological activity

  • RNA helicase
  • required for [SW|ribosome] assembly [Pubmed|23175651]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • [SW|DEAD-box RNA helicases] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|CshA], [protein|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|DeaD], [protein|0362D937D985846AEE4D0DEA57B62F915E8D35E5|YfmL]
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 35-208) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 235-385) (according to UniProt)
  • Structure

  • [PDB|5IVL] ([protein|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|CshA], 80% coverage, 40% identity) [Pubmed|28238534]
  • [SW|Localization]

  • cytoplasma, colocalizes with the ribosomes [Pubmed|16352840]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C489 ([gene|C83BD80DE0FD187D07B914F64696438ED5130107|cshB]::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1051 (Δ[gene|C83BD80DE0FD187D07B914F64696438ED5130107|cshB]::cat), available in [SW|Jörg Stülke]'s lab
  • BKE25140 (Δ[gene|C83BD80DE0FD187D07B914F64696438ED5130107|cshB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCCAGCTCCTTAA, downstream forward: _UP4_AAGAAAAGAAAGTAGGGGAA
  • BKK25140 (Δ[gene|C83BD80DE0FD187D07B914F64696438ED5130107|cshB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCCAGCTCCTTAA, downstream forward: _UP4_AAGAAAAGAAAGTAGGGGAA
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1064 (spc), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|20572937]
  • FLAG-tag construct

  • GP1011 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [ homepage]
  • References

  • 16352840,12399512,20572937,23175651,28238534,30337909