SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


36.72 kDa
protein length
328 aa Sequence Blast
gene length
987 bp Sequence Blast
metabolism of aminoacylated fructose

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,351,110 → 3,352,096

    The protein


  • 2 [SW|SIS domain]s (aa 15-153, aa 181-311) (according to UniProt)
  • Modification

  • phosphorylated on Arg-48 [Pubmed|22517742]
  • Structure

  • [PDB|3EUA]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR]: repression, [Pubmed|21398478], in [regulon|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • '' [protein|C87E74FB67B53DD1C68916AA121388C60CE66E92|FrlB]'': repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • additional information

  • the [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|yurJ] operon is strongly downregulated in a [gene|search|cshA ]mutant [Pubmed|23175651]
  • view in new tab



  • '' [protein|search|frlB]'': repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
  • view in new tab

    Biological materials


  • MGNA-A594 (yurP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32610 (Δ[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTTCACTCCTCGTT, downstream forward: _UP4_TGATCTGAAAATGAAGAACC
  • BKK32610 (Δ[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTTCACTCCTCGTT, downstream forward: _UP4_TGATCTGAAAATGAAGAACC
  • References

  • 22517742,23175651,21815947,15556630,18083814,12618455,21347729,18763711,21398478,15378759