SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


anti-[SW|sigma factor] to [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF], protein serine kinase, phosphorylates [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|SpoIIAA]
16.21 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast
control of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activity; phosphorylation and inactivation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|SpoIIAA]
anti-[SW|sigma factor], protein serine kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,444,208 → 2,444,648

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|SpoIIAA]
  • negative regulator (by binding) of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]
  • ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
  • ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
  • Protein family

  • anti-sigma-factor family (with [protein|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|RsbW], according to UniProt)
  • Structure

  • [PDB|1L0O] (complex with [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF], Geobacillus stearothermophilus) [pubmed|11955433]
  • [PDB|1TIL] (complex with [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|SpoIIAA], Geobacillus stearothermophilus) [pubmed|15236958]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|1556084,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • view in new tab


    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • strongly repressed in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials


  • BKE23460 (Δ[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTCAAGGTGCATTTCAT, downstream forward: _UP4_CTTTGTAATTAAGGAGATTT
  • BKK23460 (Δ[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTCAAGGTGCATTTCAT, downstream forward: _UP4_CTTTGTAATTAAGGAGATTT
  • labs

  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 31350897
  • Modeling of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation

  • 24067622,22312331,20298743
  • Original Publications

  • 8358793,7570023,15023063,15351644,8460142,9077448,12923101,8820658,10864495,16824103,12867473,8955289,10476035,8764398,8764397,14744853,9826498,9826499,15175314,1938874,12676949,8126438,11684022,8846916,1948031,3114419,11846550,15201047,2123551,15205443,8885263,8332059,8168129,11701124,8824593,1556084,15687200,20817675,25278935,11955433,15236958