SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


response regulator aspartate phosphatase, controls [protein|search|ComA ]activity
43.68 kDa
protein length
371 aa Sequence Blast
gene length
1116 bp Sequence Blast
control of [protein|search|ComA ]activity
response regulator aspartate phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    2,062,150 → 2,063,265

    The protein

    Catalyzed reaction/ biological activity

  • control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity [Pubmed|16816200]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Effectors of protein activity

  • binding of [protein|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|PhrK] inhibits RapK activity [Pubmed|16816200]
  • Structure

  • [PDB|4I1A] ([protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|RapI], 30% identity) [pubmed|23526881]
  • Expression and Regulation



    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11466295], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|25666134]
  • view in new tab

    Biological materials


  • BKE18910 (Δ[gene|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAACCCCTCTTTCTG, downstream forward: _UP4_ATGAATCAGGTGGAGGGAAT
  • BKK18910 (Δ[gene|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAACCCCTCTTTCTG, downstream forward: _UP4_ATGAATCAGGTGGAGGGAAT
  • References

  • 11466295,16816200,20817675,25225273,25666134,23526881