SubtiBank SubtiBank
yppD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yppD

unknown
locus
BSU_22280
pI
4.34
mw
9.38 kDa
protein length
gene length
246 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,339,226 → 2,339,471

    Expression and Regulation

    Operons

    genes
    [gene|C8EFD001C76F3C35EFCDF30F50E94769696900D9|yppD]-[gene|C23EE127990420733E6EEE4598B814026C270372|yppE]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A507 (yppD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/507 NBRP B. subtilis, Japan]
  • BKE22280 (Δ[gene|C8EFD001C76F3C35EFCDF30F50E94769696900D9|yppD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTGTACCTCCCTTTC, downstream forward: _UP4_TGAATTTGTGAGTGAAATTT
  • BKK22280 (Δ[gene|C8EFD001C76F3C35EFCDF30F50E94769696900D9|yppD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTGTACCTCCCTTTC, downstream forward: _UP4_TGAATTTGTGAGTGAAATTT
  • References

  • 14651647