SubtiBank SubtiBank
ycnC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycnC

similar to transcriptional regulator ([SW|TetR family])
locus
BSU_03850
pI
6.21
mw
33.39 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    437,474 → 438,352

    The protein

    Protein family

  • [SW|TetR family]
  • [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 2-62) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C993D176CE1B93A74D34B45DFFE30295245E2BD2|ycnC]-[gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE03850 (Δ[gene|C993D176CE1B93A74D34B45DFFE30295245E2BD2|ycnC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATGGCTTCCTTCTT, downstream forward: _UP4_ACTTAGAGAAAAGAAGGGAT
  • BKK03850 (Δ[gene|C993D176CE1B93A74D34B45DFFE30295245E2BD2|ycnC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATGGCTTCCTTCTT, downstream forward: _UP4_ACTTAGAGAAAAGAAGGGAT
  • References

    Reviews

  • 24006471
  • Original publications

  • 22383849