SubtiBank SubtiBank
ycnC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycnC

similar to transcriptional regulator ([SW|TetR family])
locus
BSU_03850
pI
6.21
mw
33.39 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    437,474 → 438,352

    The protein

    Protein family

  • [SW|TetR family]
  • Expression and Regulation

    Operons

    genes
    [gene|C993D176CE1B93A74D34B45DFFE30295245E2BD2|ycnC]-[gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE03850 (Δ[gene|C993D176CE1B93A74D34B45DFFE30295245E2BD2|ycnC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATGGCTTCCTTCTT, downstream forward: _UP4_ACTTAGAGAAAAGAAGGGAT
  • BKK03850 (Δ[gene|C993D176CE1B93A74D34B45DFFE30295245E2BD2|ycnC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATGGCTTCCTTCTT, downstream forward: _UP4_ACTTAGAGAAAAGAAGGGAT
  • References

    Reviews

  • 24006471
  • Original publications

  • 22383849