SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


3-phosphoshikimate 1-carboxyvinyltransferase
45.08 kDa
protein length
428 aa Sequence Blast
gene length
1287 bp Sequence Blast
biosynthesis of aromatic amino acids
3-phosphoshikimate 1-carboxyvinyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    2,367,954 → 2,369,240

    Phenotypes of a mutant

  • essential [Pubmed|28189581,30666812]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphoenolpyruvate + 3-phosphoshikimate = phosphate + 5-O-(1-carboxyvinyl)-3-phosphoshikimate (according to Swiss-Prot)
  • Protein family

  • EPSP synthase family (with [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|MurAA] and [protein|523B01B5E7141C7DFC28CE67EB92580F49C20844|MurAB], according to UniProt)
  • Effectors of protein activity

  • inhibited by glyphosate [pubmed|30666812]
  • Structure

  • [PDB|3RMT] (from ''B. halodurans'', 68% identity, 87% similarity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab


    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • BKE22600 (Δ[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CTTATCTCGTTTCATTTTTT, downstream forward: _UP4_TGAAGTTTTACTTCAGGATT
  • Expression vectors

  • for expression in ''B. subtilis'', in [SW|pBQ200]: piGEM2, available in [SW|Fabian Commichau]'s lab
  • labs

  • [SW|Fabian Commichau], Göttingen, Germany [ homepage]
  • References


  • 12966138
  • Original publications

  • 3924737,3106153,6436812,1551827,8419914,21815947,28189581,30666812, 3111378, 7744055