SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


modulator of [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]-dependent repression, [protein|CA0939064E70A97434FA450A69E779FD89880613|McsA] activates kinase activity of [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB]
20.88 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
control of [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR] activity
activator of [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB] kinase activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    101,927 → 102,484

    The protein


  • [SW|UVR domain] (aa 139-174) (according to UniProt)
  • Modification

  • phosphorylated on Arg-169 [Pubmed|22517742]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • view in new tab

    Biological materials


  • MGNA-B929 (yacH::erm), available at the [ NBRP B. subtilis, Japan]
  • ''mcsA::aphA3'' available from the Gerth lab
  • BKE00840 (Δ[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTTTTCACCCGCTTAT, downstream forward: _UP4_GATAGTGAGGAGGAACAGGA
  • BKK00840 (Δ[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTTTTCACCCGCTTAT, downstream forward: _UP4_GATAGTGAGGAGGAACAGGA
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • Antibody

  • available in Gerth lab
  • References

  • 12923084,8793870,11179229,9987115,16497325,19226326,9987115,11544224,22517742