SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


46.45 kDa
protein length
428 aa Sequence Blast
gene length
1287 bp Sequence Blast
pyrimidine biosynthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    1,621,374 → 1,622,660

    The protein

    Catalyzed reaction/ biological activity

  • (S)-dihydroorotate + H2O --> H+ + N-carbamoyl-L-aspartate (according to UniProt)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8C53FEBB2BCCE45A686119B7ECE4C266D2C0822A|PucH]
  • Structure

  • [PDB|3GRI] (from ''Staphylococcus aureus subsp. aureus mw2'', 60% identity, 72% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials


  • BKE15500 (Δ[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTTCGTTTAGTATCCAGC, downstream forward: _UP4_TATGAAGAGGGGAGACTTGT
  • BKK15500 (Δ[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTTCGTTTAGTATCCAGC, downstream forward: _UP4_TATGAAGAGGGGAGACTTGT
  • References

  • 8206849,1709162,16522191