SubtiBank SubtiBank
pyrC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pyrC

dihydroorotase
locus
BSU_15500
pI
5.43
mw
46.45 kDa
protein length
428 aa Sequence Blast
gene length
1287 bp Sequence Blast
function
pyrimidine biosynthesis
product
dihydroorotase
essential
no
ec
3.5.2.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    1,621,374 → 1,622,660

    The protein

    Catalyzed reaction/ biological activity

  • (S)-dihydroorotate + H2O --> H+ + N-carbamoyl-L-aspartate (according to UniProt)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8C53FEBB2BCCE45A686119B7ECE4C266D2C0822A|PucH]
  • Structure

  • [PDB|3GRI] (from ''Staphylococcus aureus subsp. aureus mw2'', 60% identity, 72% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15500 (Δ[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTTCGTTTAGTATCCAGC, downstream forward: _UP4_TATGAAGAGGGGAGACTTGT
  • BKK15500 (Δ[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTTCGTTTAGTATCCAGC, downstream forward: _UP4_TATGAAGAGGGGAGACTTGT
  • References

  • 8206849,1709162,16522191