SubtiBank SubtiBank
tenI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

tenI

thiazole tautomerase
locus
BSU_11660
pI
8.13
mw
22.78 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
biosynthesis of thiamine
product
thiazole tautomerase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    1,243,134 → 1,243,751

    The protein

    Catalyzed reaction/ biological activity

  • 2-[(2R,5Z)-2-carboxy-4-methylthiazol-5(2H)-ylidene]ethyl phosphate --> 2-(2-carboxy-4-methylthiazol-5-yl)ethyl phosphate (according to UniProt)
  • Protein family

  • thiazole tautomerase family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|8FAEB6342E087BEDC16FDF5585B03B90ACFF8D11|ThiE]
  • Structure

  • [PDB|1YAD]
  • Expression and Regulation

    Operons

    genes
    [gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
    description
    [Pubmed|1898926]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE11660 (Δ[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTAGCTCTTCTACCGGCT, downstream forward: _UP4_TCCCGCAAGCTAAAGGAGAT
  • BKK11660 (Δ[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTAGCTCTTCTACCGGCT, downstream forward: _UP4_TCCCGCAAGCTAAAGGAGAT
  • References

    Reviews

  • 10382260,22616866
  • Original publications

  • 15709744,1898926,21534620