SubtiBank SubtiBank
ydcC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydcC

unknown
locus
BSU_04630
pI
9.60
mw
42.03 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    516,241 → 517,257

    Phenotypes of a mutant

  • defect in sporulation [Pubmed|14523133]; some production of small spores, reduced [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] activity [Pubmed|26735940]
  • The protein

    Modification

  • phosphorylated on Thr-197 and Thr-201 [Pubmed|20509597]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|200BE4802FCE3C860565B374EAADC9C1FEEF3E49|acpS]-[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ydcC]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ydcC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C122 (ydcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2120 NBRP B. subtilis, Japan]
  • BKE04630 (Δ[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ydcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCCCTTTTTCTCAATTG, downstream forward: _UP4_TAACCGCCAAAGGCCAAACA
  • BKK04630 (Δ[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ydcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATGATAACCTCCTTT, downstream forward: _UP4_TAGTCTGCATATTAGGGAAA
  • References

  • 14523133,12662922,15699190,20509597,26735940