SubtiBank SubtiBank
thrZ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

thrZ

threonyl-tRNA synthetase (minor)
locus
BSU_37560
pI
5.75
mw
73.20 kDa
protein length
638 aa Sequence Blast
gene length
1917 bp Sequence Blast
function
translation
product
threonyl-tRNA synthetase (minor)
essential
no
ec
6.1.1.3
synonyms
thrS2

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.10|Aminoacyl-tRNA synthetases]
  • Gene

    Coordinates
    3,854,256 → 3,856,172

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-threonine + tRNAThr --> AMP + diphosphate + H+ + L-threonyl-tRNAThr (according to UniProt)
  • Protein family

  • [SW|Class-II aminoacyl-tRNA synthetase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3E1131CFA3EDEB3865638F09BE2F6B6ED2570BE2|ThrS]:
  • [SW|Domains]

  • [SW|TGS domain] (aa 1-64) (according to UniProt)
  • Structure

  • [PDB|1TJE] (from ''Escherichia coli'', 43% identity, 65% similarity) [Pubmed|15525511]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|CA74CB721842927F67FBC3B5C27D2EE46B30CE1C|thrZ]-[gene|4A3CA47533B217F595E7B600923DA31228B94DA8|ywhA]
    description
    [Pubmed|1379177]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1379177], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • induced by threonine limitation ([SW|T-box]) [Pubmed|19258532]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE37560 (Δ[gene|CA74CB721842927F67FBC3B5C27D2EE46B30CE1C|thrZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAGAACACTCCTTAT, downstream forward: _UP4_TAGGATAAAAGCTGTGAATT
  • BKK37560 (Δ[gene|CA74CB721842927F67FBC3B5C27D2EE46B30CE1C|thrZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAGAACACTCCTTAT, downstream forward: _UP4_TAGGATAAAAGCTGTGAATT
  • References

  • 19258532,8288542,1379177,17114254,21815947,29794222