SubtiBank SubtiBank
yycE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yycE

unknown
locus
BSU_40430
pI
5.37
mw
15.45 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,156,931 → 4,157,350

    The protein

    [SW|Domains]

  • [SW|VOC domain] (aa 9-133) (according to UniProt)
  • Structure

  • [PDB|1TWU]
  • Expression and Regulation

    Operons

    genes
    [gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]-[gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B829 (yycE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1828 NBRP B. subtilis, Japan]
  • BKE40430 (Δ[gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTTACCATCTCCTT, downstream forward: _UP4_TGATTCTTTCTTATGCTAAA
  • BKK40430 (Δ[gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTTACCATCTCCTT, downstream forward: _UP4_TGATTCTTTCTTATGCTAAA