SubtiBank SubtiBank
ypnP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypnP

putative damage inducible, Na+ driven multidrug efflux pump
locus
BSU_21710
pI
10.05
mw
48.31 kDa
protein length
445 aa Sequence Blast
gene length
1338 bp Sequence Blast
function
unknown
product
putative damage inducible, Na+ driven multidrug efflux pump
essential
no
synonyms
dinF

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.15|Multidrug exporters/ based on homology]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,288,669 → 2,290,006

    The protein

    Protein family

  • [SW|MOP exporter family]
  • [SW|multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family] (according to UniProt)
  • Structure

  • [PDB|3VVO] (MATE multidrug exporter from Pyrococcus furiosus, 25% identity) [pubmed|23535598]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|CA85B14720E86D2E609388D561B56ADA880B2190|ypnP]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/ypnP.html DBTBS]) null
    view in new tab

    Biological materials

    Mutant

  • MGNA-A890 (ypnP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/890 NBRP B. subtilis, Japan]
  • BKE21710 (Δ[gene|CA85B14720E86D2E609388D561B56ADA880B2190|ypnP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCTCCTTGTGTTC, downstream forward: _UP4_TAAGTGAAGCACTGCGAAAA
  • BKK21710 (Δ[gene|CA85B14720E86D2E609388D561B56ADA880B2190|ypnP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCTCCTTGTGTTC, downstream forward: _UP4_TAAGTGAAGCACTGCGAAAA
  • References

    Research papers

  • 23535598