SubtiBank SubtiBank
aimR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

aimR

viral quorum sensor, phage SPbeta lytic/lysogenic regulator
locus
BSU_20860
pI
5.86
mw
45.16 kDa
protein length
386 aa Sequence Blast
gene length
1161 bp Sequence Blast
function
SPbeta lysis-lysogeny coordinator
product
SPbeta arbitrium transcription factor
essential
no
synonyms
yopK

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,208,994 → 2,210,154

    The protein

    Structure

  • Apo-form: [PDB|5XYB] ([Pubmed|30224798]), [PDB|5ZW5] ([Pubmed|30323253]), [PDB|6IPX] ([Pubmed|30421358]), [PDB|6HP3]([Pubmed|30745087]), [PDB|6JG5] ([Pubmed|31149347])
  • Complexed with AimP hexapeptide ([protein|20735BFECA52826F0F4D55843EEE7798F414993C|AimP]): [PDB|5Y24] ([Pubmed|30224798]), [PDB|5ZW6] ([Pubmed|30323253]), [PDB|6IM4] ([Pubmed|30421358]), [PDB|6HP5] ([Pubmed|30745087]), [PDB|6JG9] ([Pubmed|31149347])
  • Complexed with DNA: [PDB|6HP7] ([Pubmed|30745087]), [PDB|6JG8] ([Pubmed|31149347])
  • Biological materials

    Mutant

  • BKE20860 (Δ[gene|CAE7D8E45DA7CDE99D3EA114DF7E368A0A126389|aimR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTCCCCTCATTTCT, downstream forward: _UP4_TAAAGGAGGTGAGACAATGA
  • BKK20860 (Δ[gene|CAE7D8E45DA7CDE99D3EA114DF7E368A0A126389|aimR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTCCCCTCATTTCT, downstream forward: _UP4_TAAAGGAGGTGAGACAATGA
  • References

    Research papers

  • 30323253,30224798,30421358,30745087,31149347