SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


ATP-dependent Clp protease proteolytic subunit (class III heat-shock protein)
21.00 kDa
protein length
197 aa Sequence Blast
gene length
594 bp Sequence Blast
protein degradation
ATP-dependent Clp protease proteolytic subunit

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,546,234 → 3,546,827

    Phenotypes of a mutant

  • increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]
  • the mutation suppresses the heat sensitivity of spores overexpressing ''[gene|85DE3CB6CDA61C141C6030367C0A13BB642160B9|cmpA]'' [Pubmed|26387458]
  • non-motile [Pubmed|27014237]
  • The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of proteins to small peptides in the presence of ATP and magnesium. Alpha-casein is the usual test substrate. In the absence of ATP, only oligopeptides shorter than five residues are hydrolyzed (such as succinyl-Leu-Tyr-|-NHMec, and Leu-Tyr-Leu-|-Tyr-Trp, in which cleavage of the -Tyr-|-Leu- and -Tyr-|-Trp bonds also occurs) (according to UniProt)
  • Protein family

  • Peptidase S14 family (with [protein|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|TepA], according to UniProt)
  • Modification

  • phosphorylated on Arg-13 [Pubmed|22517742]
  • Effectors of protein activity

  • the novel antibiotic ADEP (acyldepsipeptides) dysregulates [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] activity and allows [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] degradation in the absence of an ATPase subunit ([protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC], [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE], or [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]) [Pubmed|21969594]
  • Structure

  • [PDB|3KTG] [Pubmed|20305655]
  • [SW|Localization]

  • cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX], [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] and [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE] [Pubmed|18786145,18689473]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9643546], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|9643546,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • induced by heat ([protein|search|CtsR]) [Pubmed|9987115]
  • view in new tab

    Biological materials


  • ''clpP::spec'' and ''clpP::cat'', available in the [SW|Leendert Hamoen] lab
  • BP99 (''clpP''::''tet''), available in [SW|Fabian Commichau]'s lab [Pubmed|25610436]
  • GP551 (spc), available in [SW|Jörg Stülke]'s lab
  • QB4916 (spc), available in [SW|Ulf Gerths]'s and [SW|Jörg Stülke]'s labs
  • 1S139 (''clpP''::''erm''), available at [ BGSC]
  • 1S140 ( ''clpP''::''spec''), available at [ BGSC]
  • BKE34540 (''[gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1822 and GP1786 (''[gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]''::''erm'', available in [SW|Jörg Stülke]'s lab)
  • GPUG1 (erm), available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • BKE34540 (Δ[gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA
  • BKK34540 (Δ[gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA
  • GFP fusion

  • C-terminal GFP fusions (both single copy and as 2th copy in ''amyE'' locus, also as CFP and YFP variants) available in the [SW|Leendert Hamoen] lab
  • Antibody

  • available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • labs

  • [SW|Leendert Hamoen], Newcastle University, UK [ homepage]
  • References


  • 16211032,17302811,23375660,23479438,19609260,19781636,26639779,28748186
  • Original Publications

  • 9643546,10809708,11807061,9987115,14679237,18689476,15317791,17586624,11684022,12923101,17560370,16899079,19226326,20070525,9987115,11544224,14763982,9643546,19767395,11112444,9535081,18689473,20305655,20852588,16200071,21969594,22080375,22517742,17380125,12598648,9890793,20049702,20049702,23927726,24263382,24226776,24417481,15378759,23361916,24942655,25212124,25433860,25610436,26387458,27014237,27669037,28760849,29186773,29625553,28333276,31362989