SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


29.25 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
methionine salvage

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    1,424,767 → 1,425,546

    Phenotypes of a mutant

  • reduced growth with 5-methylthioribose as single sulfur source [Pubmed|24837359]
  • The protein

    Catalyzed reaction/ biological activity

  • 2-ketoglutaramate + H2O --→ 2-oxoglutarate + NH3 [Pubmed|24837359]
  • Protein family

  • carbon-nitrogen hydrolase superfamily (with [protein|BDAA216E832B8EB267CED6456A0045254DD0E97D|YhcX], according to UniProt)
  • [SW|Domains]

  • CN hydrolase (aa 3-238) (according to UniProt)
  • Structure

  • [PDB|3P8K] (from Staphylococcus aureus, 42% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-A784 (ykrU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13570 (Δ[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTAACACCCCAAA, downstream forward: _UP4_TAAAAAATATATTGACAACT
  • BKK13570 (Δ[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTAACACCCCAAA, downstream forward: _UP4_TAAAAAATATATTGACAACT
  • References

  • 15102328,12022921,11545674,24837359