SubtiBank SubtiBank
qoxB

qoxB

cytochrome aa3 quinol oxidase (subunit I)
locus
BSU_38160
pI
8.85
mw
73.66 kDa
protein length
649 aa Sequence Blast
gene length
1950 bp Sequence Blast
function
respiration
product
cytochrome aa3 quinol oxidase (subunit I)
essential
no
ec
1.10.3.-
synonyms
ipa-38d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,915,319 → 3,917,268

    Phenotypes of a mutant

  • inactivation of ''[gene|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • inactivation of ''qoxB'' facilitates without a wall (due to reduction of oxidative stress) [Pubmed|26051891]
  • The protein

    Catalyzed reaction/ biological activity

  • 2 quinol + O2 --> 2 quinone + 2 H2O (according to UniProt)
  • Protein family

  • heme-copper respiratory oxidase family (with [protein|20D1174554A03EECE233A1A045F6DF83AF799959|CtaD], according to UniProt)
  • Paralogous protein(s)

  • [protein|20D1174554A03EECE233A1A045F6DF83AF799959|CtaD]
  • [SW|Cofactors]

  • Cu(B) [Pubmed|10837475]
  • Structure

  • [PDB|1FFT] ([protein|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|QoxA]-[protein|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|QoxB]-[protein|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|QoxC] complex from ''E. coli'', 52% identity) [Pubmed|11017202]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|qoxA]-[gene|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]-[gene|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|qoxC]-[gene|03335DC50CED7B38E2380640AE108ADA09A2CBDF|qoxD]
    description
    [Pubmed|1316894]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA binding, in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • the presence of an iron-responsive element bound by [SW|CitB] between ''[SW|feuA]'' and ''[SW|feuB]'' suggests iron-dependent regulation by [SW|CitB] [Pubmed|10468622]
  • view in new tab

    Biological materials

    Mutant

  • BKE38160 (Δ[gene|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGGCTTCCTCCTTTC, downstream forward: _UP4_ATTTCCGAATAAGGAGGCGT
  • BKK38160 (Δ[gene|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGGCTTCCTCCTTTC, downstream forward: _UP4_ATTTCCGAATAAGGAGGCGT
  • References

  • 11073895,1316894,20351111,10551842,18763711,21821766,10837475,24779955,22211522,26196462,26051891,11017202,27503613