SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cytochrome aa3 quinol oxidase (subunit I)
73.66 kDa
protein length
649 aa Sequence Blast
gene length
1950 bp Sequence Blast
cytochrome aa3 quinol oxidase (subunit I)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,915,319 → 3,917,268

    Phenotypes of a mutant

  • inactivation of ''[gene|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • inactivation of ''qoxB'' facilitates without a wall (due to reduction of oxidative stress) [Pubmed|26051891]
  • The protein

    Catalyzed reaction/ biological activity

  • 2 quinol + O2 --> 2 quinone + 2 H2O (according to UniProt)
  • Protein family

  • heme-copper respiratory oxidase family (with [protein|20D1174554A03EECE233A1A045F6DF83AF799959|CtaD], according to UniProt)
  • Paralogous protein(s)

  • [protein|20D1174554A03EECE233A1A045F6DF83AF799959|CtaD]
  • [SW|Cofactors]

  • Cu(B) [Pubmed|10837475]
  • Structure

  • [PDB|1FFT] ([protein|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|QoxA]-[protein|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|QoxB]-[protein|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|QoxC] complex from ''E. coli'', 52% identity) [Pubmed|11017202]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA binding, in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • the presence of an iron-responsive element bound by [SW|CitB] between ''[SW|feuA]'' and ''[SW|feuB]'' suggests iron-dependent regulation by [SW|CitB] [Pubmed|10468622]
  • view in new tab

    Biological materials


  • BKE38160 (Δ[gene|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGGCTTCCTCCTTTC, downstream forward: _UP4_ATTTCCGAATAAGGAGGCGT
  • BKK38160 (Δ[gene|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGGCTTCCTCCTTTC, downstream forward: _UP4_ATTTCCGAATAAGGAGGCGT
  • References

  • 11073895,1316894,20351111,10551842,18763711,21821766,10837475,24779955,22211522,26196462,26051891,11017202,27503613