SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional regulator (LysR family), activator of the ywbH-ywbG operon
34.52 kDa
protein length
301 aa Sequence Blast
gene length
903 bp Sequence Blast
control of expression of the ywbH-ywbG operon
transcriptional regulator (LysR family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    3,932,198 → 3,933,103

    The protein

    Protein family

  • [SW|LysR family]
  • Effectors of protein activity

  • acetate activates [protein|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|YwbI] to bind DNA [Pubmed|26060272]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9139923], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-B675 (ywbI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38310 (Δ[gene|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCTTCACCCTTTCTA, downstream forward: _UP4_AAAGATAGTAAAGGATGATG
  • BKK38310 (Δ[gene|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCTTCACCCTTTCTA, downstream forward: _UP4_AAAGATAGTAAAGGATGATG
  • References

  • 9139923,26060272