SubtiBank SubtiBank
yfiF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfiF

similar to transcription factor ([SW|AraC family])
locus
BSU_08250
pI
8.08
mw
36.04 kDa
protein length
314 aa Sequence Blast
gene length
945 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    898,961 → 899,905

    The protein

    Protein family

  • [SW|AraC family]
  • Expression and Regulation

    Operons

    genes
    [gene|CC5ED09FC661476160443898A083FF41A1F70DCE|yfiF]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yfiF.html DBTBS]) null
    view in new tab

    Biological materials

    Mutant

  • MGNA-C296 (yfiF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2294 NBRP B. subtilis, Japan]
  • BKE08250 (Δ[gene|CC5ED09FC661476160443898A083FF41A1F70DCE|yfiF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAACGCCTCCTAACA, downstream forward: _UP4_TAAGATGTCCTGAAATGACA
  • BKK08250 (Δ[gene|CC5ED09FC661476160443898A083FF41A1F70DCE|yfiF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAACGCCTCCTAACA, downstream forward: _UP4_TAAGATGTCCTGAAATGACA
  • References

  • 23504016