SubtiBank SubtiBank
thiF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thiF

hydroxyethylthiazole phosphate biosynthesis
locus
BSU_11700
pI
5.62
mw
36.24 kDa
protein length
336 aa Sequence Blast
gene length
1011 bp Sequence Blast
function
biosynthesis of thiamine
product
unknown
essential
no
synonyms
yjbU

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    1,245,808 → 1,246,818

    The protein

    Protein family

  • HesA/MoeB/ThiF family (with [protein|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|MoeB] and [protein|37DA3A036937660AA750065B46B581D911D73D00|YrvM], according to UniProt)
  • Paralogous protein(s)

  • [protein|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|MoeB]
  • Structure

  • [PDB|1ZFN] (from ''E. coli'', 35% identity, 51% similarity) [Pubmed|15896804]
  • Expression and Regulation

    Operons

    genes
    [gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
    description
    [Pubmed|1898926]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B166 (yjbU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1165 NBRP B. subtilis, Japan]
  • BKE11700 (Δ[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCTGCCTTGAATACCTGC, downstream forward: _UP4_GGGTAATAAAAGGAGTGTAG
  • BKK11700 (Δ[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCTGCCTTGAATACCTGC, downstream forward: _UP4_GGGTAATAAAAGGAGTGTAG
  • References

    Reviews

  • 19348578,10382260
  • Original publications

  • 14567704,15896804,1898926,16356850