SubtiBank SubtiBank
purS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

purS

phosphoribosylformylglycinamidine synthase
locus
BSU_06460
pI
4.59
mw
9.62 kDa
protein length
gene length
255 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylformylglycinamidine synthase
essential
no
ec
6.3.5.3
synonyms
yexA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    702,319 → 702,573

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + L-glutamine + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide --> 2-(formamido)-N1-(5-phospho-D-ribosyl)acetamidine + ADP + H+ + L-glutamate + phosphate (according to UniProt)
  • Protein family

  • UPF0062 family (single member, according to UniProt)
  • Structure

  • [PDB|1T4A]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A920 (yexA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/920 NBRP B. subtilis, Japan]
  • BKE06460 (Δ[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGCTGACATAAACTT, downstream forward: _UP4_GAGGTTGAGGAGGTAGTCGC
  • BKK06460 (Δ[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGCTGACATAAACTT, downstream forward: _UP4_GAGGTTGAGGAGGTAGTCGC
  • References

  • 15301532,15301530,10784038,3036807,7638212,15378759