SubtiBank SubtiBank
ndhF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ndhF

NADH dehydrogenase (subunit 5)
locus
BSU_01830
pI
10.15
mw
55.30 kDa
protein length
505 aa Sequence Blast
gene length
1518 bp Sequence Blast
function
respiration
product
NADH dehydrogenase (subunit 5)
essential
no
synonyms
ybxE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    205,409 → 206,926

    Phenotypes of a mutant

  • severe growth defect [pubmed|31420537]
  • The protein

    Catalyzed reaction/ biological activity

  • quinone + H+ + NADH --> quinol + NAD+ (according to UniProt)
  • Protein family

  • complex I subunit 5 family (single member, according to UniProt)
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|4HE8] (from Thermus thermophilus, corresponds to aa 70 ... 352, 28.% identity) [pubmed|23417064]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]-[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]-[gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]-[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]-[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • highly expressed at high iron concentrations [pubmed|31420537]
  • Biological materials

    Mutant

  • BKE01830 (Δ[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAATTCTCCCTTTT, downstream forward: _UP4_ATTTCATAAGGAGCTAATCT
  • BKK01830 (Δ[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAATTCTCCCTTTT, downstream forward: _UP4_ATTTCATAAGGAGCTAATCT
  • References

  • 18763711,31420537,23417064