SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


urease (alpha subunit)
61.01 kDa
protein length
569 aa Sequence Blast
gene length
1710 bp Sequence Blast
utilization of urea as alternative nitrogen source
urease (alpha subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of urea]
  • Gene

    3,766,714 → 3,768,423

    The protein

    Catalyzed reaction/ biological activity

  • 2 H+ + H2O + urea --> CO2 + 2 NH4+ (according to UniProt)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • [SW|Domains]

  • Urease domain (aa 132-569) (according to UniProt)
  • [SW|Cofactors]

  • nickel
  • Structure

  • [PDB|5A6T] (from Sporosarcina pasteurii, 65% identity) [pubmed|26580226]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9287005], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9287005], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, [Pubmed|9287005], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9287005], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12374841], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|9287005,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced by nitrogen limitation ([protein|search|GlnR], [protein|search|TnrA]) [Pubmed|9287005]
  • view in new tab

    Biological materials


  • BKE36640 (Δ[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATATTCCTCCCGTGACA, downstream forward: _UP4_TGATAAGACGCGGCCGGAGT
  • BKK36640 (Δ[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATATTCCTCCCGTGACA, downstream forward: _UP4_TGATAAGACGCGGCCGGAGT
  • References


  • 23539618,19363030
  • Original publications

  • 12618455,16199586,9287005,9287005,12374841,9287005,25755103,26580226