SubtiBank SubtiBank
melA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

melA

alpha-galactosidase
locus
BSU_30300
pI
5.84
mw
49.10 kDa
protein length
432 aa Sequence Blast
gene length
1299 bp Sequence Blast
function
utilization of melibiose and raffinose family oligosaccharides (raffinose, stachyose)
product
alpha-galactosidase
essential
no
ec
3.2.1.22
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,100,881 → 3,102,179

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal, non-reducing alpha-D-galactose residues in alpha-D-galactosides, including galactose oligosaccharides, galactomannans and galactohydrolase (according to Swiss-Prot)
  • Protein family

  • [SW|Glycosyl hydrolase 4 family] (according to UniProt)
  • Kinetic information

  • KM for melibiose: 10 mM [pubmed|31138628]
  • KM for raffinose: 25 mM [pubmed|31138628]
  • [SW|Cofactors]

  • NAD+ [pubmed|31138628]
  • Mn2+ [pubmed|31138628]
  • Structure

  • [PDB|5C3M] (from Geobacillus stearothermophilus, 28% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849,9387221]
    view in new tab

    genes
    [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials

    Mutant

  • BKE30300 (Δ[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATATTGCTTCCCCCTT, downstream forward: _UP4_TAAAAACTAGGGGACCGCTC
  • BKK30300 (Δ[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATATTGCTTCCCCCTT, downstream forward: _UP4_TAAAAACTAGGGGACCGCTC
  • References

  • 9387221,22383849,22900538,31138628