SubtiBank SubtiBank
yotG
The papers of the month are back! Check them out! Link here

yotG

unknown
locus
BSU19890
pI
4.40
mw
12.33 kDa
protein length
105 aa Sequence Blast
gene length
315 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,154,266 → 2,154,583

    Expression and Regulation

    Operons

    genes
    [gene|AFCA823BA7245A295B3282602A928D2CD0F8CD27|yosX]-[gene|B604367A80B7D3DF4A940C12A35EDF37B0E415F2|yotB]-[gene|6416197EF316D74998012765EF9819072C38D2E2|yotC]-[gene|470037C34BD5D3EB5BDAD85BD4178ABDB6330A62|yotD]-[gene|5C8815965146BCD8ED238258B3F820AA17241165|yotE]-[gene|177BAE8E5143CBE479B8EF6814F2A1066E72D658|yotF]-[gene|CE176CE32089F79C9BAC36641DDBBA8C9C38C957|yotG]-[gene|5240CC5115326ACBB2B73F7610987C842C246F24|yotH]-[gene|ADFAFAB949F0BED0681E35C3055DB0984DA7910E|yotI]-[gene|C5508537A5CB1E2F71329CD822242EE988D395F3|yotJ]-[gene|3C740F35E67CDD7FB6BF19E0FF43F973D254EF3E|yotK]-[gene|3899DF460037B569066F452EC50AD97672AA5ACA|yotM]-[gene|46826326719EB32B5733953EC090FD91CB59C5B6|sprB]
    description
    [Pubmed|25299644]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25299644], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|25299644], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulatory mechanism

  • [protein|6977F18870004AD236539D9409255815E6BE9241|CsoR]: repression, [Pubmed|20233928], in [regulon|6977F18870004AD236539D9409255815E6BE9241|CsoR regulon]
  • regulation

  • ''[protein|search|sprB]'': expressed during the middle and late stages of [SW|sporulation] [Pubmed|25299644]
  • view in new tab

    Biological materials

    Mutant

  • BKE19890 (Δ[gene|CE176CE32089F79C9BAC36641DDBBA8C9C38C957|yotG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTTTCCTTCATAAGATCAA, downstream forward: _UP4_AAAACATGATTGGAGGAAAG
  • BKK19890 (Δ[gene|CE176CE32089F79C9BAC36641DDBBA8C9C38C957|yotG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTTTCCTTCATAAGATCAA, downstream forward: _UP4_AAAACATGATTGGAGGAAAG
  • References

  • 25299644,9387222