SubtiBank SubtiBank
trmR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

trmR

tRNA wobble uridine modifying methyltransferase
locus
BSU_27360
pI
5.57
mw
24.92 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
introduction of 5-methoxyuridine modification in tRNA (U34)
product
tRNA wobble uridine modifying methyltransferase
essential
no
synonyms
yrrM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,795,082 → 2,795,735

    The protein

    Catalyzed reaction/ biological activity

  • methylation of (5-hydroxyuridine) ho5U containing tRNA to 5-methoxyuridine (mo5U) [pubmed|29982645]
  • 5-hydroxyuridine34 in tRNA + S-adenosyl-L-methionine --> 5-methoxyuridine34 in tRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • SAM [pubmed|29982645]
  • Structure

  • [PDB|5ZW3] [pubmed|29982645]
  • [PDB|5ZW4] (bound to tRNA) [pubmed|29982645]
  • Expression and Regulation

    Operons

    genes
    [gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]-[gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]-[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]-[gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]-[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A853 (yrrM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/853 NBRP B. subtilis, Japan]
  • BKE27360 (Δ[gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTACAAACAGCCTCCCGT, downstream forward: _UP4_AGTAAAAAGAAGAGGTGAAC
  • BKK27360 (Δ[gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTACAAACAGCCTCCCGT, downstream forward: _UP4_AGTAAAAAGAAGAGGTGAAC
  • References

    Research papers

  • 29982645,31358606