SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to [SW|ABC transporter ](permease)
27.72 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
[SW|ABC transporter ](permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,174,410 → 4,175,120

    Expression and Regulation



    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[SW|DnaA] [Pubmed| 27902860,15743949]
  • view in new tab

    Biological materials


  • MGNA-B842 (yybL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40600 (Δ[gene|CE98D731B8D9BDBF4EB119346BB59F5E5C48C827|yybL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAATTTTCATTGTATTT, downstream forward: _UP4_AAATGAGGATTAAAGGCTTT
  • BKK40600 (Δ[gene|CE98D731B8D9BDBF4EB119346BB59F5E5C48C827|yybL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAATTTTCATTGTATTT, downstream forward: _UP4_AAATGAGGATTAAAGGCTTT
  • References

  • 10092453,23199363,15743949,27902860