SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


33.46 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,487,504 → 1,488,397

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12354229], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [pubmed|29914988], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|24214949], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre]: repression, in [regulon|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|24214949], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|24214949]
  • induced by iron starvation (second wave) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393,12354229]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the ''[protein|0932DDC285635C02067A3302CEDA302FE4269179|YkuN]-[protein|CEC1B5DF1E548597FE333895ECA476AB9DFFFDD7|YkuO]-[protein|ECAFD2873ADE6B65C7B3C27FF26E0FAAA74839CC|YkuP]'' operon is strongly unregulated in a ''[SW|kre]'' mutant [Pubmed|26110430]
  • view in new tab

    Biological materials


  • MGNA-B338 (ykuO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14160 (Δ[gene|CEC1B5DF1E548597FE333895ECA476AB9DFFFDD7|ykuO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGATGCCGTAACAGCGGTTG, downstream forward: _UP4_ATTCATTAGAGGAGGAACAA
  • BKK14160 (Δ[gene|CEC1B5DF1E548597FE333895ECA476AB9DFFFDD7|ykuO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGATGCCGTAACAGCGGTTG, downstream forward: _UP4_ATTCATTAGAGGAGGAACAA
  • References

  • 12354229,12107147,24214949,26110430,29133393,29914988