SubtiBank SubtiBank
bdbD

bdbD

thiol-disulfide oxidoreductase, required for the formation of thiol disulfide bonds in several proteins
locus
BSU_33480
pI
5.09
mw
24.76 kDa
protein length
222 aa Sequence Blast
gene length
669 bp Sequence Blast
function
oxidative folding of proteins
product
thiol-disulfide oxidoreductase
essential
no
synonyms
yvgV

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,438,065 → 3,438,733

    Phenotypes of a mutant

  • loss of transformability [Pubmed|11744713]
  • sensitive to osmotic shock [Pubmed|22540663]
  • several proteins are absent from the membrane proteome of a ''[gene|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|bdbC]-[gene|CED818CEF5B573A40F382157375E60C0B331F098|bdbD]'' mutant: [Pubmed|22540663]
  • the membrane proteins [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP], [protein|EC287BBD7AB1EB44A33BF29144448F53D06AC6D9|TcyP], [protein|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|SipU], [protein|497C9654DC7514FF738D18E1F083299C43003A4C|LytA], and [protein|573EBCDC59BB0167F79F00D87B916843031048D8|YxaI] [Pubmed|22540663]
  • the cytoplasmic or membrane-associated proteins [protein|search|GlkX], [protein|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|ProA], [protein|E7741ED6F15044900BDC5F0584246469D2D4D586|PyrAA], [protein|D57DC8A53E52BC4A2EA894E3C9FD983592882918|PyrAB], [protein|40655595D0C573B4CB75FB255CBB01A6ACF1F94D|PyrH], [protein|0197A037D2AF049B295E1DA60187D4614B2BAC51|PyrE], [protein|5D0D0D2413377FCA92440334E92B5A27A5963D9E|PyrF], [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS], [protein|D8637043C7E2291589C966E95F94DC61B1A8AB75|YbxA] [Pubmed|22540663]
  • The protein

    Catalyzed reaction/ biological activity

  • formation of thiol disulfide bonds in [protein|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|ComEC] and [protein|19D76B80386F825109C5FB4A34881D5D20F366DB|ComGC] (together with [protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|BdbC]) [Pubmed|11744713]
  • Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • [SW|Domains]

  • Thioredoxin domain (aa 37-220) (according to UniProt)
  • [SW|Cofactors]

  • Ca (2+) [Pubmed|19535335]
  • Structure

  • [PDB|3EU3] (reduced form), [PDB|3EU4] (oxidized form) [Pubmed|19535335]
  • [SW|Localization]

  • membrane, faced to the outer side of the membrane [Pubmed|19535335]
  • Expression and Regulation

    Operons

    genes
    [gene|CED818CEF5B573A40F382157375E60C0B331F098|bdbD]-[gene|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|bdbC]
    description
    [Pubmed|11744713]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11744713], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A033 (yvgV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/33 NBRP B. subtilis, Japan]
  • BKE33480 (Δ[gene|CED818CEF5B573A40F382157375E60C0B331F098|bdbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGACACCTCATCGTT, downstream forward: _UP4_AAAGAGCTGAAAGGGAAGTA
  • BKK33480 (Δ[gene|CED818CEF5B573A40F382157375E60C0B331F098|bdbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGACACCTCATCGTT, downstream forward: _UP4_AAAGAGCTGAAAGGGAAGTA
  • References

    Reviews

  • 25212246
  • Original publications

  • 19535335,11744713,15661011,11872755,16751195,11844773,12480901,22540663,28698374