SubtiBank SubtiBank
relA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

relA

GTP pyrophosphokinase ([regulon|stringent response|stringent response])
locus
BSU_27600
pI
6.96
mw
84.65 kDa
protein length
734 aa Sequence Blast
gene length
2205 bp Sequence Blast
function
synthesis and degradation of (p)ppGpp, triggering the [regulon|stringent response|stringent response]
product
GTP pyrophosphokinase
essential
no
ec
2.7.6.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • Gene

    Coordinates
    2,820,529 → 2,822,733

    Phenotypes of a mutant

  • requirement for valine [Pubmed|24163341]
  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of ''[gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24163341]
  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant acquires suppressor mutations in ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24682323,24163341]
  • mutation in ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]'' results in increased motility and chaining via elevated [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD] level [Pubmed|25331430]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)
  • Protein family

  • RelA/SpoT family (with [protein|1107A963C253FBEE8716507BD0EC0E7CD5642B12|SasA] and [protein|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|SasB], according to UniProt)
  • [SW|Domains]

  • N-terminal ppGpp hydrolase domain ([SW|HD domain]) (aa 31-180) [Pubmed|24163341]
  • central ppGpp synthetase domain [Pubmed|24163341]
  • [SW|TGS domain] (aa 392-453) (according to UniProt)
  • C-terminal [SW|ACT domain] (aa 660-734) (responsible for fine-tuning of activation at the ribosome) [pubmed|32184768]
  • Effectors of protein activity

  • (p)ppGpp synthesis is activated by uncharged tRNAs in a ribosome-dependent manner
  • the interaction with [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA] inhibits the hydrolysis of ppGpp [Pubmed|25899641]
  • heat stress triggers (p)ppGpp synthesis [pubmed|32176689]
  • the presence of immature tRNAs due to depletion of [protein|594F2D36BE71A45303A33AA2A2931F56F0A969ED|RNase P] or [protein|C40C5D35ED53D343C8200248FCCB010BAB388054|RNase Z] triggers (p)ppGpp synthesis by [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] [pubmed|31003868]
  • Structure

  • [PDB|6YXA] (aa 1 ... 556) [pubmed|32937119]
  • [PDB|6HTQ] (the [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA]-[SW|ribosome] complex) [pubmed|32937119]
  • [PDB|1VJ7] (N-terminal catalytic fragment, from ''Streptococcus equisimilis'', 60% identity) [Pubmed|15066282]
  • Expression and Regulation

    Operons

    genes
    [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]-[gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]
    description
    [Pubmed|9383190]
    view in new tab

    Biological materials

    Mutant

  • GP3429 ''relA-6xHis-cat'', available in Jörg Stülke's lab
  • ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]'' mutant [Pubmed|9383190] - note that ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]'' mutants are prone to suppressor mutations in the ''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]'' or ''[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' loci [Pubmed|18670626]
  • GP2066 (''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::mls''), available in [SW|Jörg Stülke]'s lab
  • BKE27600 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
  • BKK27600 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • [SW|Jade Wang], University of Wisconsin–Madison [https://bact.wisc.edu/people_profile.php?t=rf&p=jdwang2 homepage]
  • References

    Reviews

  • 27149325,30980074
  • Original publications

  • 25331430,9383190,10209741,24489751,19447912,13129942,12372825,12081964,11948165,12419222,23028324,24163341,24682323,25899641,15066282,27775002,27875634,31003868,15066282,32176689,32184768,31003868,32393900,32937119