SubtiBank SubtiBank
yuzA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yuzA

general stress protein
locus
BSU31380
pI
6.41
mw
8.33 kDa
protein length
gene length
234 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    3,224,864 → 3,225,100

    Expression and Regulation

    Operons

    genes
    [gene|CEF2AA772D85DEFB4F43394C75E49E90A462097E|yuzA]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE31380 (Δ[gene|CEF2AA772D85DEFB4F43394C75E49E90A462097E|yuzA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTGCAACCTCCTCC, downstream forward: _UP4_TAGGATATCAATCACGCTGA
  • BKK31380 (Δ[gene|CEF2AA772D85DEFB4F43394C75E49E90A462097E|yuzA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTGCAACCTCCTCC, downstream forward: _UP4_TAGGATATCAATCACGCTGA
  • References

  • 11544224,15699190,16497325