SubtiBank SubtiBank
yhfS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhfS

similar to acetyl-CoA C-acetyltransferase
locus
BSU_10350
pI
5.12
mw
38.24 kDa
protein length
364 aa Sequence Blast
gene length
1095 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,109,388 → 1,110,482

    The protein

    Protein family

  • [SW|thiolase-like superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|07498A0A3CB598A6E388540124A4F56E781C86FA|FadA], [protein|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|MmgA]
  • Structure

  • [PDB|4E1L] (from ''Clostridium Difficile'', 38% identity)
  • [PDB|3SS6] (the protein of ''B. anthracis'', 38% identity, 66% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|yhfU]-[gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|11717296], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|11717296]
  • additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    genes
    [gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B279 (yhfS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1278 NBRP B. subtilis, Japan]
  • BKE10350 (Δ[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTTATACTGTACACT, downstream forward: _UP4_TAGGCTTTTTCATAGGACAC
  • BKK10350 (Δ[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTTATACTGTACACT, downstream forward: _UP4_TAGGCTTTTTCATAGGACAC
  • References

  • 22383849,12368242