SubtiBank SubtiBank


phosphotyrosine protein phosphatase, antagonist to [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]
28.81 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
protein tyrosine dephosphorylation
phosphotyrosine protein phosphatase, antagonist to [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • Gene

    3,731,005 → 3,731,769

    The protein

    Catalyzed reaction/ biological activity

  • H2O + O-phospho-L-tyrosyl-[protein] --> L-tyrosyl-[protein] + phosphate (according to UniProt)
  • dephosphorylation of [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|Ugd], [protein|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|TuaD] and [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] [Pubmed|15866923]
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Structure

  • [PDB|3QY7] [Pubmed|21605684]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20815827], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|26283769], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|26283769], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-A077 (ywqE::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1609 (spc), available in [SW| Jörg Stülke]'s lab
  • GP1610 (''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]'', spc), available in [SW| Jörg Stülke]'s lab
  • BKE36240 (Δ[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTAGCCCCCTTTTT, downstream forward: _UP4_TAACAGCCGATTCTCATTTC
  • BKK36240 (Δ[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTAGCCCCCTTTTT, downstream forward: _UP4_TAACAGCCGATTCTCATTTC
  • References

  • 15866923,12970183,21605684,20815827,21605684,20817675,26283769,27148221