SubtiBank SubtiBank
kduI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

kduI

5-keto-4-deoxyuronate isomerase
locus
BSU_22130
pI
5.11
mw
30.98 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
function
utilization of galacturonic acid
product
5-keto-4-deoxyuronate isomerase
essential
no
ec
5.3.1.17
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • Gene

    Coordinates
    2,325,854 → 2,326,681

    The protein

    Catalyzed reaction/ biological activity

  • 5-dehydro-4-deoxy-D-glucuronate --> 3-deoxy-D-glycero-2,5-hexodiulosonate (according to UniProt)
  • Protein family

  • KduI family (single member, according to UniProt)
  • Structure

  • [PDB|1YWK] (from Enterococcus faecalis, 48% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CFAEF60AD73F18C8DB5EF042210602B149D51152|kduI]-[gene|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|kduD]
    description
    [Pubmed|17322190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17322190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]: repression, [Pubmed|17322190], in [regulon|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|17322190], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|KdgR]) [Pubmed|17322190]
  • view in new tab

    Biological materials

    Mutant

  • BKE22130 (Δ[gene|CFAEF60AD73F18C8DB5EF042210602B149D51152|kduI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATTTCCCCCTTGGT, downstream forward: _UP4_ATTCCAATGGATGGGCTGAA
  • BKK22130 (Δ[gene|CFAEF60AD73F18C8DB5EF042210602B149D51152|kduI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATTTCCCCCTTGGT, downstream forward: _UP4_ATTCCAATGGATGGGCTGAA
  • References

  • 17322190