SubtiBank SubtiBank
yycA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yycA

unknown
locus
BSU_40490
pI
9.68
mw
73.41 kDa
protein length
685 aa Sequence Blast
gene length
2058 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,161,103 → 4,163,160

    The protein

    Protein family

  • glycosyltransferase 39 family (with [protein|7039FCF49F97FFEF37ED48D6F860E3873A5CF308|YkcB], according to UniProt)
  • Paralogous protein(s)

  • [protein|7039FCF49F97FFEF37ED48D6F860E3873A5CF308|YkcB]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1CB229DE87D56674903A8348657FA3B3117FEADD|yycC]-[gene|00F319EEC8420F859BA2657B9D4D1281853A94BD|yycB]-[gene|CFEA05E10517C00222126F959A1D2DCE7604E478|yycA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]) [Pubmed|12823818]
  • view in new tab

    genes
    [gene|CFEA05E10517C00222126F959A1D2DCE7604E478|yycA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B833 (yycA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1832 NBRP B. subtilis, Japan]
  • BKE40490 (Δ[gene|CFEA05E10517C00222126F959A1D2DCE7604E478|yycA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTTTCACCTCTTTA, downstream forward: _UP4_TAAAAAAAGAGGCTTGGATG
  • BKK40490 (Δ[gene|CFEA05E10517C00222126F959A1D2DCE7604E478|yycA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTTTCACCTCTTTA, downstream forward: _UP4_TAAAAAAAGAGGCTTGGATG
  • References

  • 20512483