SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|RNA polymerase] forespore-specific (early) [SW|sigma factor] SigF
29.22 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
transcription of [SW|sporulation] genes (early forespore)
[SW|RNA polymerase] forespore-specific (early) [SW|sigma factor] SigF

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,443,429 → 2,444,196

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]
  • Structure

  • [PDB|1L0O] (complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB], Geobacillus stearothermophilus) [pubmed|11955433]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|1556084,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • view in new tab


    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • strongly repressed in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials


  • BKE23450 (Δ[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCACATCCATAACAAATC, downstream forward: _UP4_TAGTCTGCAGTGCAGGCTAG
  • BKK23450 (Δ[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCACATCCATAACAAATC, downstream forward: _UP4_TAGTCTGCAGTGCAGGCTAG
  • labs

  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 20833318,31350897
  • The [SW|SigF regulon]

  • 16497325,26506528
  • Modeling of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation

  • 24067622,22312331,20298743
  • Original Publications

  • 10503549,8358793,7570023,9555886,3007937,8460142,9077448,10323866,10869437,7768847,14744853,8759874,10864495,1744043,16824103,11701124,1902463,8171000,1904527,15351644,15882622,8764398,8764397,9826498,9826499,2492512,1629150,12676949,7592342,11684022,8846916,1948031,8126438,3114419,12081956,9150232,15205443,9004507,8168129,2123551,8824593,19390092,17498739,8021191,1556084,15687200,12107147,18208527,10049355,23169620,21037003,20817675,21935351,25101664,11955433,28838935,29702640