SubtiBank SubtiBank
sigV
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sigV

[SW|RNA polymerase] ECF-type [SW|sigma factor] SigV, required for resistance to lytic enzymes
locus
BSU_27120
pI
9.04
mw
19.57 kDa
protein length
166 aa Sequence Blast
gene length
501 bp Sequence Blast
function
resistance to lytic enzymes
product
[SW|RNA polymerase] ECF-type [SW|sigma factor] SigV
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,769,850 → 2,770,350

    Phenotypes of a mutant

  • increased sensitivity to lysozyme, this can be suppressed by overexpression of'' [gene|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA]'' [Pubmed|21856855]
  • The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • [SW|ECF subfamily] (according to UniProt)
  • Effectors of protein activity

  • activity is controlled by the interaction with [protein|ED1DDA187692683D9862EC0E858B80CD56C48045|RsiV], proteolytic degradation of [protein|ED1DDA187692683D9862EC0E858B80CD56C48045|RsiV] releases active [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] [Pubmed|23687273]
  • Structure

  • [PDB|5WUQ] (the [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]-[protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] complex, 28% identity for [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]) [pubmed|28319136]
  • Additional information

  • Expression of the [SW|SigV regulon] in increased in ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutants [Pubmed|22362028]
  • Expression and Regulation

    Operons

    genes
    [gene|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]-[gene|ED1DDA187692683D9862EC0E858B80CD56C48045|rsiV]-[gene|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA]-[gene|FC37C7A0C0D9F50CA1D44B8D939CF06E210D4B38|yrhK]
    description
    [Pubmed|21856855]

    sigma factors

  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21856855], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • induced by lysozyme ([protein|search|SigV]) [Pubmed|21856855]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A144 (sigV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/144 NBRP B. subtilis, Japan]
  • 1A907 ( ''sigV''::''kan''), [Pubmed|15838020], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A907&Search=1A907 BGSC]
  • BKE27120 (Δ[gene|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCAATAAAGGGCTCCT, downstream forward: _UP4_TTGACGAAGGAGGATCTTTC
  • BKK27120 (Δ[gene|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCAATAAAGGGCTCCT, downstream forward: _UP4_TTGACGAAGGAGGATCTTTC
  • labs

  • [SW|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas Wiegert-Dateien/Thomas Wiegert.html Homepage]
  • References

    Reviews

  • 24921931,26901131,31286585
  • Original publications

  • 14993308,16274938,17675383,19745567,22362028,23687273,20817771,21926231,21856855,26399770,29069433,30020925,28319136