SubtiBank SubtiBank
yjaV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjaV

[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]-dependent [SW|sporulation] gene
locus
BSU_11290
pI
5.00
mw
16.01 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
function
[category|SW 4.2|Sporulation]
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,205,981 → 1,206,538

    Phenotypes of a mutant

  • defect in sporulation [Pubmed|14523133]
  • Expression and Regulation

    Operons

    genes
    [gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]-[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    genes
    [gene|2BF1CA62F5B8B54A25B70721D39B5BD38C0203EB|yjaU]-[gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]-[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B144 (yjaV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1143 NBRP B. subtilis, Japan]
  • BKE11290 (Δ[gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCATCTGCCGCCCTTC, downstream forward: _UP4_TAAGAAAAACCTTCCATGTT
  • BKK11290 (Δ[gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCATCTGCCGCCCTTC, downstream forward: _UP4_TAAGAAAAACCTTCCATGTT
  • References

  • 14523133