SubtiBank SubtiBank
ywnG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywnG

unknown
locus
BSU_36570
pI
4.00
mw
18.32 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,761,182 → 3,761,700

    The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|891DBC0CAB749A3ED4103CD603C61DED34B058B1|ywnH]-[gene|D09E0307CD931FBAE32B6FF5E19D71A612F0F790|ywnG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A205 (ywnG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/205 NBRP B. subtilis, Japan]
  • BKE36570 (Δ[gene|D09E0307CD931FBAE32B6FF5E19D71A612F0F790|ywnG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTCATCTTTATCCAGAC, downstream forward: _UP4_TAATGATGAGACAGGACAGG
  • BKK36570 (Δ[gene|D09E0307CD931FBAE32B6FF5E19D71A612F0F790|ywnG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTCATCTTTATCCAGAC, downstream forward: _UP4_TAATGATGAGACAGGACAGG