SubtiBank SubtiBank
ycsN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ycsN

similar to aryl-alcohol dehydrogenase
locus
BSU_04150
pI
5.28
mw
33.99 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    466,042 → 466,944

    The protein

    Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • [SW|Aldo/keto reductase 2 subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|YhdN]
  • Structure

  • [PDB|4R90] (from ''Salmonella Enterica'', 51% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|5BBA2769A9C0EDB56625F008A55470C2E2885AA4|pbpC]-[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C025 (ycsN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2023 NBRP B. subtilis, Japan]
  • BKE04150 (Δ[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAAATCCCTCTTTTC, downstream forward: _UP4_TAAAAAGCATCAGTTTACCA
  • BKK04150 (Δ[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAAATCCCTCTTTTC, downstream forward: _UP4_TAAAAAGCATCAGTTTACCA