SubtiBank SubtiBank
ycsN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycsN

similar to aryl-alcohol dehydrogenase
locus
BSU_04150
pI
5.28
mw
33.99 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    466,042 → 466,944

    The protein

    Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • [SW|Aldo/keto reductase 2 subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4DF9B105ABA64AFD5106EE75FCC9EFAB52BEFC83|YhdN]
  • Structure

  • [PDB|4R90] (from ''Salmonella Enterica'', 51% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|5BBA2769A9C0EDB56625F008A55470C2E2885AA4|pbpC]-[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C025 (ycsN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2023 NBRP B. subtilis, Japan]
  • BKE04150 (Δ[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAAATCCCTCTTTTC, downstream forward: _UP4_TAAAAAGCATCAGTTTACCA
  • BKK04150 (Δ[gene|D0A2506FDCEA41D2A8910AC2837B46E0B311D63B|ycsN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAAATCCCTCTTTTC, downstream forward: _UP4_TAAAAAGCATCAGTTTACCA