SubtiBank SubtiBank
nhaX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nhaX

general stress protein, putative regulator of [protein|A7F1B4C0D32E18773170BFBEEB94E5EF55C7DB97|NhaC]
locus
BSU_09690
pI
4.44
mw
17.87 kDa
protein length
166 aa Sequence Blast
gene length
501 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yheK

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    1,044,373 → 1,044,873

    The protein

    Protein family

  • universal stress protein A family (with [protein|5A4CDE1CFE319E4471A15702ED1632C96270528D|YxiE], according to UniProt)
  • Structure

  • [PDB|1WJG] (from Thermus thermophilus, 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|D0BBFE1706429A98B7E93998794061A112FE8ECA|nhaX]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE09690 (Δ[gene|D0BBFE1706429A98B7E93998794061A112FE8ECA|nhaX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCTCACCCTTTCAA, downstream forward: _UP4_TGAGCACGCCCTGTGCTCAC
  • BKK09690 (Δ[gene|D0BBFE1706429A98B7E93998794061A112FE8ECA|nhaX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCTCACCCTTTCAA, downstream forward: _UP4_TGAGCACGCCCTGTGCTCAC
  • References

  • 11544224,11274110,23033921