SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


threonine dehydratase
46.49 kDa
protein length
422 aa Sequence Blast
gene length
1266 bp Sequence Blast
biosynthesis of branched-chain amino acids
threonine dehydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • Gene

    2,292,769 → 2,294,037

    The protein

    Catalyzed reaction/ biological activity

  • L-threonine --> 2-oxobutanoate + NH4+ (according to UniProt)
  • Protein family

  • serine/threonine dehydratase family (with [protein|4E7390A74A8261E8B732E94859E90FE256AD64EE|DsdA], according to UniProt)
  • [SW|Domains]

  • ACT-like domain (aa 339-413) (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|1TDJ] (the enzyme from ''E. coli'', 39% identity) [Pubmed|9562556]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • view in new tab

    Biological materials


  • BKE21770 (Δ[gene|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACAGATTCCTTTCTT, downstream forward: _UP4_TAATTTTTTTACACAACCGC
  • BKK21770 (Δ[gene|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACAGATTCCTTTCTT, downstream forward: _UP4_TAATTTTTTTACACAACCGC
  • Expression vector

  • pGP2289: expression of ''ilvA'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP519 (in [SW|pAC5]), available in [SW|Stülke] lab
  • References

  • 18083814,12618455,15060025,9562556,12618455,12107147,24163341,26220295