SubtiBank SubtiBank
ilvA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ilvA

threonine dehydratase
locus
BSU_21770
pI
5.54
mw
46.49 kDa
protein length
422 aa Sequence Blast
gene length
1266 bp Sequence Blast
function
biosynthesis of branched-chain amino acids
product
threonine dehydratase
essential
no
ec
4.3.1.19
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • Gene

    Coordinates
    2,292,769 → 2,294,037

    The protein

    Catalyzed reaction/ biological activity

  • L-threonine --> 2-oxobutanoate + NH4+ (according to UniProt)
  • Protein family

  • serine/threonine dehydratase family (with [protein|4E7390A74A8261E8B732E94859E90FE256AD64EE|DsdA], according to UniProt)
  • [SW|Domains]

  • ACT-like domain (aa 339-413) (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|1TDJ] (the enzyme from ''E. coli'', 39% identity) [Pubmed|9562556]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA]-[gene|DE113BB32600349C472D3417B760D640B65B01AB|ypmP]
    description
    [Pubmed|15060025]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • BKE21770 (Δ[gene|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACAGATTCCTTTCTT, downstream forward: _UP4_TAATTTTTTTACACAACCGC
  • BKK21770 (Δ[gene|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACAGATTCCTTTCTT, downstream forward: _UP4_TAATTTTTTTACACAACCGC
  • Expression vector

  • pGP2289: expression of ''ilvA'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP519 (in [SW|pAC5]), available in [SW|Stülke] lab
  • References

  • 18083814,12618455,15060025,9562556,12618455,12107147,24163341,26220295