SubtiBank SubtiBank
ycnJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycnJ

copper transporter
locus
BSU_03950
pI
10.10
mw
59.64 kDa
protein length
541 aa Sequence Blast
gene length
1626 bp Sequence Blast
function
uptake of copper
product
copper transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.1|Copper]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    446,801 → 448,426

    Phenotypes of a mutant

  • growth-defective under copper-limiting conditions [Pubmed|19168619]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of copper [Pubmed|19168619]
  • Protein family

  • N-terminal part: CopC family (single member, according to UniProt)
  • C-terminal part: CopD family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|19168619]
  • Expression and Regulation

    Operons

    genes
    [gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]
    description
    [Pubmed|22904286,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22904286], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK]: repression, [Pubmed|22904286,19168619], in [regulon|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
  • view in new tab

    Biological materials

    Mutant

  • BKE03950 (Δ[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCAGACACCACCTT, downstream forward: _UP4_AAGACCAATTAAGGAGTGTT
  • BKK03950 (Δ[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCAGACACCACCTT, downstream forward: _UP4_AAGACCAATTAAGGAGTGTT
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • References

  • 19168619,22904286,22383849