SubtiBank SubtiBank
ppsC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ppsC

plipastatin synthetase
locus
BSU_18320
pI
5.35
mw
287.19 kDa
protein length
2555 aa Sequence Blast
gene length
7668 bp Sequence Blast
function
production of the antibacterial compound plipastatin
product
plipastatin synthetase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,974,881 → 1,982,548

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • partial match (more than 1,000 amino acids): [protein|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|DhbF], [protein|13EB6B903088C11D985DDB7CEC864797058FE038|PksJ], [protein|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|PksN], [protein|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|PpsA], [protein|E7A2F93B33B1899313893D362D92405232BC9097|PpsB], [protein|C1C051209943E02369356075EAA733297E9478CB|PpsE], [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC]
  • [SW|Domains]

  • 2 [SW|Carrier domain]s (aa 967-1042, aa 2003-2077) (according to UniProt)
  • Structure

  • [PDB|2VSQ] (termination module of [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC], 37% identity) [pubmed|18583577]
  • Expression and Regulation

    Operons

    genes
    [gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]-[gene|E7A2F93B33B1899313893D362D92405232BC9097|ppsB]-[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]-[gene|E73D9F1A8F54DAD4B2056CABBE580D7AD36CB042|ppsD]-[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE18320 (Δ[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCGGCATCAGTGAATCTC, downstream forward: _UP4_TAGAAAATCGTGACAGGAGA
  • BKK18320 (Δ[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCGGCATCAGTGAATCTC, downstream forward: _UP4_TAGAAAATCGTGACAGGAGA
  • References

  • 10471562,9387222,21630458,20817675,18583577,29855381