SubtiBank SubtiBank
aseR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

aseR

transcriptional repressor of the [SW|ArsR family], of [gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA] and [gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]
locus
BSU_05330
pI
6.31
mw
12.95 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
regulation of As (III) efflux
product
transcriptional repressor ([SW|ArsR family])
essential
no
synonyms
ydeT

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    579,541 → 579,876

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 1-105) (according to UniProt)
  • Effectors of protein activity

  • As(III) acts as molecular inducer [Pubmed|15948947]
  • Structure

  • [PDB|2OQG] (from Rhodococcus sp., 27% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]-[gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA]-[gene|6BA4A8575050B1BA45FF98E1F3B1F27F6C24A5E4|ydzS/1]-[gene|009BB4460A9374A8259DE7BD05724467198E0A90|ydzS/2]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]: repression, [Pubmed|15948947], in [regulon|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR regulon]
  • regulation

  • induced by As(III) ([protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]) [Pubmed|15948947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C168 (ydeT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2166 NBRP B. subtilis, Japan]
  • BKE05330 (Δ[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGCTCCTCCTTCCC, downstream forward: _UP4_TGTTGCCAGTAAGGAGGCAT
  • BKK05330 (Δ[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGCTCCTCCTTCCC, downstream forward: _UP4_TGTTGCCAGTAAGGAGGCAT
  • References

  • 15948947,16430705