SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional repressor of the ArsR family, of aseA and aseR
12.95 kDa
protein length
111 aa Sequence Blast
gene length
333 bp Sequence Blast
regulation of As (III) efflux
transcriptional repressor (ArsR family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    579,541 → 579,876

    The protein

    Protein family

  • [SW|ArsR family]
  • Effectors of protein activity

  • As(III) acts as molecular inducer [Pubmed|15948947]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]: repression, [Pubmed|15948947], in [regulon|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR regulon]
  • regulation

  • induced by As(III) ([protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]) [Pubmed|15948947]
  • view in new tab

    Biological materials


  • MGNA-C168 (ydeT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05330 (Δ[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGCTCCTCCTTCCC, downstream forward: _UP4_TGTTGCCAGTAAGGAGGCAT
  • BKK05330 (Δ[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGCTCCTCCTTCCC, downstream forward: _UP4_TGTTGCCAGTAAGGAGGCAT
  • References

  • 15948947,16430705