SubtiBank SubtiBank
aseR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

aseR

transcriptional repressor of the [SW|ArsR family], of [gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA] and [gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]
locus
BSU_05330
pI
6.31
mw
12.95 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
regulation of As (III) efflux
product
transcriptional repressor ([SW|ArsR family])
essential
no
synonyms
ydeT

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    579,541 → 579,876

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 1-105) (according to UniProt)
  • Effectors of protein activity

  • As(III) acts as molecular inducer [Pubmed|15948947]
  • Structure

  • [PDB|2OQG] (from Rhodococcus sp., 27% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]-[gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA]-[gene|6BA4A8575050B1BA45FF98E1F3B1F27F6C24A5E4|ydzS/1]-[gene|009BB4460A9374A8259DE7BD05724467198E0A90|ydzS/2]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]: repression, [Pubmed|15948947], in [regulon|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR regulon]
  • regulation

  • induced by As(III) ([protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]) [Pubmed|15948947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C168 (ydeT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2166 NBRP B. subtilis, Japan]
  • BKE05330 (Δ[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGCTCCTCCTTCCC, downstream forward: _UP4_TGTTGCCAGTAAGGAGGCAT
  • BKK05330 (Δ[gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGCTCCTCCTTCCC, downstream forward: _UP4_TGTTGCCAGTAAGGAGGCAT
  • References

  • 15948947,16430705