SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


tmRNA-binding protein
17.95 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
tmRNA-binding protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other]
  • Gene

    3,451,248 → 3,451,718

    Phenotypes of a mutant

  • impaired growth at high and low temperatures [Pubmed|15805528]
  • inactivation of ''[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]'' reduces sporulation efficiency to 23% that of wild type cells; delayed entry into sporulation [Pubmed|26735940]
  • essential in the absence of [protein|F7F780D11A6B11EB62CFA5202D1243A381AB40E1|BrfA] [ reference]
  • The protein

    Protein family

  • smpB family (single member, according to UniProt)
  • Structure

  • [PDB|1P6V] (from ''Aquifex aeolicus'', 55% identity, complex with the tRNA domain of [protein|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|SsrA]) [Pubmed|12904796]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab



  • ''[protein|search|yvaK]'': [protein|search|SigB] [Pubmed|11544224]
  • view in new tab



  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • MGNA-A494 (yvaI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33600 (Δ[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGAACCTCCTCTCT, downstream forward: _UP4_TAAAGGCATAGTGCTTGATT
  • BKK33600 (Δ[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGAACCTCCTCTCT, downstream forward: _UP4_TAAAGGCATAGTGCTTGATT
  • labs

  • [SW|Chet Price], Davis, USA [ homepage]
  • References


  • 12730326,10881189
  • Original publications

  • 18977770,11395451,17369301,10881189,15805528,12904796,26735940