SubtiBank SubtiBank
sndC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sndC

sulphur compound N-deacetylase
locus
BSU_10070
pI
5.86
mw
43.11 kDa
protein length
396 aa Sequence Blast
gene length
1191 bp Sequence Blast
function
unknown
product
sulphur compound N-deacetylase
essential
no
synonyms
yhaA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,080,150 → 1,081,340

    Phenotypes of a mutant

  • a ''[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA] [gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB] [gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]'' triple mutant does not grow with N-acetyl cysteine and S-(2-succino)cysteine as the single sources of sulfur [Pubmed|23944997,29626092]
  • The protein

    Protein family

  • [SW|peptidase M20A family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D6F1906CE8386F78F451D6B794F74DE4AD25AC9C|YkuR], [protein|0DE66A10D9475DC57A140561E8532D3EC038FD6F|SndA]
  • [protein|C99AA3FDBB561BCED60915078DC746690C071753|SndB]:
  • Structure

  • [PDB|4EWT] (from Staphylococcus aureus, 43% identity) [pubmed|23385746]
  • Expression and Regulation

    Operons

    genes
    [gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]
    description
    [Pubmed|12107147]

    regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    genes
    [gene|5EC5DD1844AD995AC1FA6FA76922C77CC514462D|yhfA]-[gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B500 (yhaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1499 NBRP B. subtilis, Japan]
  • BKE10070 (Δ[gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCCGCTTCCCCCTTTT, downstream forward: _UP4_CTATAAAAAAACAGCCGGAG
  • BKK10070 (Δ[gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCCGCTTCCCCCTTTT, downstream forward: _UP4_CTATAAAAAAACAGCCGGAG
  • References

  • 12107147,23944997,23385746,29626092