SubtiBank SubtiBank
ysxE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ysxE

inner spore coat protein
locus
BSU_28100
pI
5.64
mw
40.41 kDa
protein length
341 aa Sequence Blast
gene length
1026 bp Sequence Blast
function
protection of the spore
product
inner spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.3|Class III]
  • Gene

    Coordinates
    2,869,964 → 2,870,989

    The protein

    [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID]-[gene|D1EAEC9C88EDDD8FB2E7E315DE28A7A54AAAB4D2|ysxE]
    description
    [Pubmed|15699190,8449878]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8449878], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,8449878]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A997 (ysxE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/997 NBRP B. subtilis, Japan]
  • BKE28100 (Δ[gene|D1EAEC9C88EDDD8FB2E7E315DE28A7A54AAAB4D2|ysxE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCACCACATTTT, downstream forward: _UP4_TCTTAATGGCGCGGACTTGT
  • BKK28100 (Δ[gene|D1EAEC9C88EDDD8FB2E7E315DE28A7A54AAAB4D2|ysxE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCACCACATTTT, downstream forward: _UP4_TCTTAATGGCGCGGACTTGT
  • References

  • 15699190,8449878,12107147,22171814