SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


component of the [protein|search|SpoIIIA]-[protein|search|SpoIIQ ]type III secretion system residing in the forespore membrane, required for [protein|search|SigG ]activation
19.01 kDa
protein length
171 aa Sequence Blast
gene length
516 bp Sequence Blast
activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]
component of a type III secretion system

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,536,181 → 2,536,696

    The protein


  • [PDB|6BS9] [pubmed|29288127]
  • [SW|Localization]

  • membrane protein [Pubmed|18485064]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18485064], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab



  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab

    Biological materials


  • BKE24420 (Δ[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGAATACAGCGCCCAGCA, downstream forward: _UP4_TAAACGTGAGGGGAGCAAAA
  • BKK24420 (Δ[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGAATACAGCGCCCAGCA, downstream forward: _UP4_TAAACGTGAGGGGAGCAAAA
  • References


  • 31350897
  • Original Publications

  • 1766372,18485064,19609349,29288127